DNA Melting Temperature Calculator

Author: Henrick Yau

DNA Melting Temperature Calculator

Calculate the melting temperature (Tm) of DNA oligonucleotides using various methods.

DNA Sequence

Length: 0 bp
GC Content: 0%

Calculation Method

μM

Display Options

What Is the DNA Melting Temperature Calculator?

The DNA Melting Temperature Calculator is a tool that helps estimate the temperature at which a DNA strand separates into two single strands. This temperature is called the melting temperature (Tm). It’s an important factor in many lab techniques that involve DNA, such as PCR (Polymerase Chain Reaction), hybridization, and probe design.

By inputting a DNA sequence and selecting one of several calculation methods, the tool provides the Tm value and suggests an optimal annealing temperature for experiments.

Formula Used

Basic (Wallace) Method:
Tm = 2°C × (A + T) + 4°C × (G + C)
Nearest-Neighbor Method:
Tm = ΔH / (ΔS + R × ln(c / 4)) − 273.15
Salt-Adjusted Method:
Tm = 81.5 + 16.6 × log₁₀[Na⁺] + 0.41 × (%GC) − 600 / length

How to Use the Calculator

Using the calculator is simple and intuitive. Here’s how to get started:

  • Enter your DNA sequence (5' to 3') in the provided text box.
  • Choose a calculation method:
    • Basic (Wallace): For short sequences under 14 bases.
    • Nearest-Neighbor: More accurate for longer or complex sequences.
    • Salt-Adjusted: Accounts for salt concentration in the solution.
  • If using the Salt-Adjusted method, input the salt concentration in mM.
  • Set the primer concentration in μM (used for Nearest-Neighbor method).
  • Use checkboxes to choose whether to display the formula details and complementary strand.
  • Click Calculate Tm to see your results.

Example Calculations

Here are a few example inputs and what you can expect from the calculator:

Example 1: Short Sequence Using Basic Method

  • DNA Sequence: ATGCATGCATGC
  • Method: Basic (Wallace)
  • Resulting Tm: 36°C
  • Annealing Temp: 31°C

Example 2: Longer Sequence with Nearest-Neighbor

  • DNA Sequence: AGTCCGATCGATCGGATCGA
  • Primer Concentration: 0.25 μM
  • Method: Nearest-Neighbor
  • Resulting Tm: ~60.5°C
  • Annealing Temp: ~55.5°C

Example 3: Salt-Adjusted Method

  • DNA Sequence: GCGCGCGCGCGC
  • Salt Concentration: 100 mM
  • Method: Salt-Adjusted
  • Resulting Tm: ~72.3°C
  • Annealing Temp: ~67.3°C

Why This Calculator Is Useful

Understanding DNA melting temperature is essential for designing successful molecular biology experiments. This calculator simplifies that process by providing fast and reliable Tm estimates based on your specific sequence and conditions.

Key benefits include:

  • Helps you choose the right temperature for PCR annealing steps.
  • Provides GC content and molecular weight of your DNA sequence.
  • Visualizes the DNA strand and its complementary pair for better understanding.
  • Supports different methods to suit different sequence lengths and experiment needs.

Frequently Asked Questions (FAQ)

What is melting temperature (Tm)?

The melting temperature is the point at which half of the DNA molecules in a sample become single-stranded. It reflects the stability of the DNA duplex.

Which calculation method should I choose?

  • Basic (Wallace): Best for short sequences (under 14 base pairs).
  • Nearest-Neighbor: Ideal for more accurate calculations involving longer sequences.
  • Salt-Adjusted: Use when working with longer sequences and varying salt concentrations.

What is GC content?

GC content refers to the percentage of guanine (G) and cytosine (C) bases in a DNA sequence. A higher GC content typically means a higher Tm.

What is the optimal annealing temperature?

This is the recommended temperature for DNA primers to bind to a template strand during PCR. It's generally 5–10°C lower than the Tm.

Can I use this for RNA or mixed sequences?

No, this tool is specifically for DNA sequences. It does not support RNA or sequences with ambiguous bases.

Conclusion

The DNA Melting Temperature Calculator is a valuable tool for researchers and students working with DNA. It simplifies an important part of experiment design, offering fast, informative results with options suited to your specific needs.